circad | circRNAs associated with diseases

hsa_circRNA_102101
Gene	CDC27	Organism	Human
Genome Locus	n/a	Build	hg19
Disease	Active Tuberculosis	ICD-10	Respiratory tuberculosis, bacteriologically and histologically confirmed (A15-A19)
DBLink	Link to database	PMID	29448254
Experimental Method
Sample Type	Peripheral Blood Mononuclear Cells (PBMCs)	Comparison	40 Active Tuberculosis (TB) patients and 40 control subjects
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TGAGTTTGGTGATTCAGCTTGC Reverse GCTTTATATGCCTTTCCTGAGCG	Statistics	Fold Change : Downregulated,2.4539 pvalue : p=0.00235
Citation
Huang, ZK, Yao, FY, Xu, JQ, Deng, Z, Su, RG, Peng, YP, Luo, Q, Li, JM (2018). Microarray Expression Profile of Circular RNAs in Peripheral Blood Mononuclear Cells from Active Tuberculosis Patients. Cell. Physiol. Biochem., 45, 3:1230-1240.